Product Details
- Verified Reactivity
- Human, Mouse, Rat, All species
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- KLH-conjugated His-tag peptide.
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq?-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq?-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume. Refer to the corresponding TotalSeq? protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq? products. For example, for any technology platform Buyer uses with TotalSeq?, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq? with that platform.- Application Notes
This antibody was raised against a linear 8X His tag. It reacts with proteins displaying repeats of 6 Histidines (His6) or more in either internal or C and N terminal regions. It is suitable for ICFC.
Clone J095G46 has been verified for immunocytochemistry (ICC).- Additional Product Notes
TotalSeq? reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library.- RRID
- AB_2892435 (BioLegend Cat. No. 362623)
Antigen Details
- Structure
- 6 repeat His amino acid
- Function
- Epitope tag
- Biology Area
- Cell Biology, Immunology
- Antigen References
-
- Zhao C, et al. 2010. Anal Biochem. 399:237
- Salichs E, et al. 2009. PLoS Genet. 5:e1000397
- Terpe K. 2003. Appl. Microbiol. Biotechnol. 60:523
- Lindner, P, et al. 1997. Biotechniques. 22:140
- Burritt JB, et al. 1995. J. Biol. Chem. 270:16974.
- Taylor RM, et al. 2007. Methods Mol. Biol. 412:429.
- Gene ID
- NA
- UniProt
- View information about His Tag on UniProt.org