Product Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Immunogen
- Human CCR5 transfectants
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq?-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
Each lot of this antibody is quality control tested by?immunofluorescent staining with flow cytometric analysis?and the oligomer sequence is confirmed by sequencing. TotalSeq?-D antibodies are compatible with?Mission Bio’s Tapestri Single-Cell Sequencing Platform?for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.?For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume.?Refer to the corresponding TotalSeq? protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq? products. For example, for any technology platform Buyer uses with TotalSeq?, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq? with that platform.- Additional Product Notes
TotalSeq?-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes.- RRID
- AB_2894570 (BioLegend Cat. No. 359141)
Antigen Details
- Structure
- G-coupled receptor family 1, membrane protein, 45 kD
- Distribution
-
Subset of T cells, monocytes
- Function
- Binds C-C chemokines and transduces an intracellular signal thought to result in proliferation and differentiation, acts as a co-receptor with CD4 for HIV-1
- Ligand/Receptor
- MIP-1α, MIP-1β, RANTES
- Cell Type
- Monocytes, T cells
- Biology Area
- Cell Biology, Immunology, Innate Immunity, Neuroinflammation, Neuroscience
- Molecular Family
- CD Molecules, Cytokine/Chemokine Receptors, GPCR
- Antigen References
-
1. Samson M, et al. 1996. Biochemistry 35:3362.
2. Raport CJ, et al. 1996. J. Biol. Chem. 271:17161.
3. Combadiere C, et al. 1996. J. Leukoc. Biol. 60:147.
4. Deng H, et al. 1996. Nature 381:661.
5. Lai J, et al. 2003. CVI. 10:1123.
6. Ma?es S, et al. 2003. J. Exp. Med. 198:1381.
7. Vaday GG, et al. 2006. Prostate 66:124. - Gene ID
- 1234 View all products for this Gene ID
- UniProt
- View information about CD195 on UniProt.org