Product Details
- Verified Reactivity
- Mouse
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Immunogen
- Mouse CXCR4-transfected cells
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq?-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/ml
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq?-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume. Refer to the corresponding TotalSeq? protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq? products. For example, for any technology platform Buyer uses with TotalSeq?, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq? with that platform.- Application Notes
Additional reported applications (for the relevant formats) include: in vivo blocking1
- Additional Product Notes
TotalSeq? reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library.- Application References
(PubMed link indicates BioLegend citation) -
- Costa MJ, et al. 2018. PLoS One. 13:e0194688 (Block) PubMed
- RRID
- AB_2800682 (BioLegend Cat. No. 146520)
Antigen Details
- Structure
- G-protein-coupled seven transmembrane receptor, 39.7 kD
- Distribution
-
T lymphocytes, monocytes, macrophages, tissue-committed stem/progenitor cells (TCSCs), mast cells, vascular smooth muscle cells (VSMCs)
- Function
- Development of cardiovascular and central nervous system, hematopoiesis, and colonization of BM by fetal liver-derived hematopoietic stem cells (HSCs) during embryogenesis, homing and egress of CD34+ CXCR4+ progenitor cells from bone marrow, and their migration into peripheral tissues. Critical role in homing of cancer cells to specific metastatic sites. Possible role in the ubiquitin proteosome system.
- Interaction
- Robo -1
- Ligand/Receptor
- CXCL12 (SDF-1)
- Cell Type
- Macrophages, Mast cells, Mesenchymal Stem Cells, Monocytes, Neural Stem Cells, T cells
- Biology Area
- Angiogenesis, Cell Biology, Cell Motility/Cytoskeleton/Structure, Immunology, Neuroscience, Neuroscience Cell Markers, Signal Transduction, Stem Cells, Ubiquitin/Protein Degradation
- Molecular Family
- CD Molecules, Cytokine/Chemokine Receptors, GPCR
- Antigen References
-
1. Kucia M, et al. 2005. Stem Cells 23:879.
2. Muller A, et al. 2001. Nature 410:50.
3. Saini V, et al. 2010. J. Biol. Chem. 285:15566.
4. Prasad A, et al. 2007. J. Leuko. Biol. 82:465.
5. De Klerck B, et al. 2005. Arthritis Res. Ther. 7:R1208.
6. Rueda P, et al. 2008. PLoS One 3:e2543.
7. Feng Y, et al. 1996. Science 272:872. - Gene ID
- 12767 View all products for this Gene ID
- UniProt
- View information about CD184 on UniProt.org